Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bgaY gene

Regulog: BgaR - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium animalis subsp. lactis AD011
Position: -191
Score: 5.16992
Position: -114
Score: 5.89582
Locus tag: BLA_0464
Name: bgaY
Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: BLA_0463
Name: bgaZ
Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: BLA_0462
Name: bgaB
Funciton: Beta-galactosidase (EC
bgaY-bgaZ-bgaB -191 5.2 AACTGTTTGCGCAATCATGC BLA_0464
Bifidobacterium dentium Bd1
Position: -270
Score: 5.09794
Position: -179
Score: 5.52128
Locus tag: BDP_0655
Name: bgaY
Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: BDP_0656
Name: bgaZ
Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: BDP_0657
Name: bgaB
Funciton: Beta-galactosidase (EC
bgaY-bgaZ-bgaB -270 5.1 TAATGTTTTCGTCATCATAG BDP_0655
Bifidobacterium longum NCC2705
Position: -44
Score: 5.83258
Locus tag: BL1170
Name: bgaY
Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: BL1169
Name: bgaZ
Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: BL1168
Name: bgaB
Funciton: Beta-galactosidase (EC
bgaY-bgaZ-bgaB -44 5.8 TGATGATAACGCAAACATTT BL1170