Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bgaR gene

Properties
Regulog: BgaR - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium angulatum DSM 20098
Position: -176
Score: 5.95376
Sequence: AAATGTTTGCGTTATCATTA
Locus tag: BIFANG_00301
Name: bgaR
Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
bgaR -176 6 AAATGTTTGCGTTATCATTA BIFANG_00301
Bifidobacterium animalis subsp. lactis AD011
Position: -174
Score: 5.89582
Sequence: GAATGTTTACGCAAACATAG
Position: -97
Score: 5.16992
Sequence: GCATGATTGCGCAAACAGTT
Locus tag: BLA_0465
Name: bgaR
Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
bgaR -174 5.9 GAATGTTTACGCAAACATAG BLA_0465
-97 5.2 GCATGATTGCGCAAACAGTT
Bifidobacterium bifidum NCIMB 41171
Position: -128
Score: 5.66184
Sequence: AAATGTTTGCGTTACCATGA
Locus tag: BbifN4_010100008751
Name: bgaR
Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
bgaR -128 5.7 AAATGTTTGCGTTACCATGA BbifN4_010100008751
Bifidobacterium breve DSM 20213
Position: -208
Score: 5.49919
Sequence: AATTGTTTACGTTATCATCA
Locus tag: BIFBRE_00761
Name: bgaR
Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
bgaR -208 5.5 AATTGTTTACGTTATCATCA BIFBRE_00761
Bifidobacterium longum NCC2705
Position: -192
Score: 5.83258
Sequence: AAATGTTTGCGTTATCATCA
Locus tag: BL1171
Name: bgaR
Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
bgaR -192 5.8 AAATGTTTGCGTTATCATCA BL1171