Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing glxK gene

Properties
Regulog: GlxR - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Actinobacteria
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium longum NCC2705
Position: 42
Score: 6.93545
Sequence: TACGGAAAACGTTTACCGTT
Locus tag: BL0845
Name: glxK
Funciton: Glycerate kinase (EC 2.7.1.31)
glxK 42 6.9 TACGGAAAACGTTTACCGTT BL0845