Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing sgaR gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium bifidum NCIMB 41171
Position: -130
Score: 5.54357
Sequence: AATTGGGAGCGCTCACATAT
Locus tag: BbifN4_010100001332
Name: sgaR
Funciton: Putative transcriptional regulator of L-ascorbate utilization, SorC family
sgaR -130 5.5 AATTGGGAGCGCTCACATAT BbifN4_010100001332