Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araQ gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -75
Score: 5.42377
Sequence: GGTTGTTAGCGCTAACTGAA
Locus tag: BAD_1413
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ -75 5.4 GGTTGTTAGCGCTAACTGAA BAD_1413
Bifidobacterium bifidum NCIMB 41171
Position: -122
Score: 5.42384
Sequence: ATCTGTGAGCGCTCACGCGT
Locus tag: BbifN4_010100001372
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ -122 5.4 ATCTGTGAGCGCTCACGCGT BbifN4_010100001372
Bifidobacterium breve DSM 20213
Position: -146
Score: 5.43068
Sequence: CAATGTGAGCGCTCACGCGA
Locus tag: BIFBRE_02212
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ -146 5.4 CAATGTGAGCGCTCACGCGA BIFBRE_02212
Bifidobacterium dentium Bd1
Position: -75
Score: 5.1259
Sequence: GCCTGTTAGCGCTAACTGAA
Locus tag: BDP_1926
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ -75 5.1 GCCTGTTAGCGCTAACTGAA BDP_1926
Bifidobacterium longum NCC2705
Position: -71
Score: 5.46808
Sequence: CAGTGTGAGCGCTAACGCAA
Locus tag: BL0275
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ -71 5.5 CAGTGTGAGCGCTAACGCAA BL0275
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -110
Score: 5.46808
Sequence: CAGTGTGAGCGCTAACGCAA
Locus tag: Blon_0423
Name: araQ
Funciton: Transcriptional regulator of central carbohydrate metabolism, LacI family
araQ -110 5.5 CAGTGTGAGCGCTAACGCAA Blon_0423