Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lyxK gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium bifidum NCIMB 41171
Position: -238
Score: 5.54357
Sequence: ATATGTGAGCGCTCCCAATT
Locus tag: BbifN4_010100001337
Name: gatC
Funciton: putative PTS system, galactitol-specific IIC component
Locus tag: BbifN4_010100001342
Name: lyxK
Funciton: L-xylulose kinase (EC 2.7.1.-)
Locus tag: BbifN4_010100001347
Name: sgaU
Funciton: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
Locus tag: BbifN4_010100001352
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
gatC-lyxK-sgaU-araD -238 5.5 ATATGTGAGCGCTCCCAATT BbifN4_010100001337