Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araB gene

Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -82
Score: 5.25024
Position: -69
Score: 5.49563
Locus tag: BAD_1412
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BAD_1411
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BAD_1410
Name: araA
Funciton: L-arabinose isomerase (EC
araB-araD-araA -82 5.3 AATAGTGAGCGTTAACAGTG BAD_1412
Bifidobacterium angulatum DSM 20098
Position: -347
Score: 5.28202
Position: -176
Score: 5.35149
Locus tag: BIFANG_00188
Name: araE
Funciton: L-arabinose-proton symporter
Locus tag: BIFANG_00187
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BIFANG_00186
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BIFANG_00185
Name: araA
Funciton: L-arabinose isomerase (EC
araE-araB-araD-araA -347 5.3 TTTTGAGAGCGTTCACATCA BIFANG_00188
Bifidobacterium animalis subsp. lactis AD011
Position: -213
Score: 5.00598
Position: -70
Score: 5.92037
Locus tag: BLA_0056
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BLA_0057
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BLA_0058
Name: araA
Funciton: L-arabinose isomerase (EC
Bifidobacterium dentium Bd1
Position: -81
Score: 5.25024
Position: -68
Score: 5.49563
Locus tag: BDP_1924
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BDP_1923
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BDP_1922
Name: araA
Funciton: L-arabinose isomerase (EC
araB-araD-araA -81 5.3 AATAGTGAGCGTTAACAGTG BDP_1924
Bifidobacterium gallicum DSM 20093
Position: -2
Score: 5.74335
Locus tag: BIFGAL_00651
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BIFGAL_00650
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BIFGAL_00649
Name: araA
Funciton: L-arabinose isomerase (EC
Bifidobacterium longum NCC2705
Position: -70
Score: 5.84275
Locus tag: BL0274
Name: araB
Funciton: Ribulokinase (EC
Locus tag: BL0273
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: BL0272
Name: araA
Funciton: L-arabinose isomerase (EC
araB-araD-araA -70 5.8 AATTGTGAGCGCTAACACCC BL0274