Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araE gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium angulatum DSM 20098
Position: -347
Score: 5.28202
Sequence: TTTTGAGAGCGTTCACATCA
Position: -176
Score: 5.35149
Sequence: AAATGTGAGCGATAACATTT
Locus tag: BIFANG_00188
Name: araE
Funciton: L-arabinose-proton symporter
Locus tag: BIFANG_00187
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BIFANG_00186
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BIFANG_00185
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araE-araB-araD-araA -347 5.3 TTTTGAGAGCGTTCACATCA BIFANG_00188
-176 5.4 AAATGTGAGCGATAACATTT