Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing pyk gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -51
Score: 6.27625
Sequence: AATTGTGAGCGCTCACAACA
Locus tag: BAD_0678
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -51 6.3 AATTGTGAGCGCTCACAACA BAD_0678
Bifidobacterium angulatum DSM 20098
Position: -131
Score: 6.09631
Sequence: AATTGTTAGCGCTCACATAA
Locus tag: BIFANG_01141
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -131 6.1 AATTGTTAGCGCTCACATAA BIFANG_01141
Bifidobacterium animalis subsp. lactis AD011
Position: -380
Score: 5.98212
Sequence: GGTTGTGAGCGCTCACAGAC
Locus tag: BLA_1494
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -380 6 GGTTGTGAGCGCTCACAGAC BLA_1494
Bifidobacterium bifidum NCIMB 41171
Position: -131
Score: 6.13774
Sequence: AGATGTGAGCGCTCACAACA
Locus tag: BbifN4_010100003349
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -131 6.1 AGATGTGAGCGCTCACAACA BbifN4_010100003349
Bifidobacterium breve DSM 20213
Position: -77
Score: 6.04597
Sequence: CAGTGTGAGCGCTCACAACA
Locus tag: BIFBRE_01051
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -77 6 CAGTGTGAGCGCTCACAACA BIFBRE_01051
Bifidobacterium dentium Bd1
Position: -126
Score: 6.19527
Sequence: AAATGTGAGCGCTCACAACA
Locus tag: BDP_0904
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -126 6.2 AAATGTGAGCGCTCACAACA BDP_0904
Bifidobacterium gallicum DSM 20093
Position: -125
Score: 5.5016
Sequence: CTATGTTAACGCTAACAACA
Locus tag: BIFGAL_00353
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -125 5.5 CTATGTTAACGCTAACAACA BIFGAL_00353
Bifidobacterium longum NCC2705
Position: -40
Score: 6.1265
Sequence: CAATGTGAGCGCTCACAACA
Locus tag: BL0988
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -40 6.1 CAATGTGAGCGCTCACAACA BL0988
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -127
Score: 6.1265
Sequence: CAATGTGAGCGCTCACAACA
Locus tag: Blon_1745
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -127 6.1 CAATGTGAGCGCTCACAACA Blon_1745
Gardnerella vaginalis 409-05
Position: -146
Score: 5.95873
Sequence: TTCTGTGAGCGTTCACAAAA
Locus tag: HMPREF0424_0607
Name: pyk
Funciton: Pyruvate kinase (EC 2.7.1.40)
pyk -146 6 TTCTGTGAGCGTTCACAAAA HMPREF0424_0607