Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing PF07944 gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -49
Score: 5.52218
Sequence: GATTGTGAGCGTTAACAAGA
Locus tag: BAD_1529
Name: PF07944
Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
Locus tag: BAD_1528
Name: aga
Funciton: Alpha-galactosidase (EC 3.2.1.22)
PF07944-aga -49 5.5 GATTGTGAGCGTTAACAAGA BAD_1529