Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing maa gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -20
Score: 5.44535
Sequence: TGGTGTGAGCGTTCACTATA
Locus tag: BAD_0431
Name: maa
Funciton: Maltose O-acetyltransferase (EC 2.3.1.79)
maa -20 5.4 TGGTGTGAGCGTTCACTATA BAD_0431
Bifidobacterium dentium Bd1
Position: -49
Score: 5.51768
Sequence: TTGCGTGAACGCTCACAACA
Locus tag: BDP_0569
Name: maa
Funciton: Maltose O-acetyltransferase (EC 2.3.1.79)
maa -49 5.5 TTGCGTGAACGCTCACAACA BDP_0569