Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing malQ1 gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium longum NCC2705
Position: -110
Score: 6.06533
Sequence: CATTGTGAGCGCTCACATCT
Locus tag: BL1570
Name: malQ1
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malQ1 -110 6.1 CATTGTGAGCGCTCACATCT BL1570
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -110
Score: 6.06533
Sequence: CATTGTGAGCGCTCACATCT
Position: -88
Score: 4.59879
Sequence: CTGTGTGAGGGCTAAAAGTA
Locus tag: Blon_2246
Name: malQ1
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malQ1 -110 6.1 CATTGTGAGCGCTCACATCT Blon_2246
-88 4.6 CTGTGTGAGGGCTAAAAGTA