Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing birA gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium breve DSM 20213
Position: -107
Score: 5.22251
Sequence: ACGTGTGAGCGTTCACACCG
Locus tag: BIFBRE_00166
Name: null
Funciton: Biotin-protein ligase (EC 6.3.4.15)
BIFBRE_00166 -107 5.2 ACGTGTGAGCGTTCACACCG BIFBRE_00166
Bifidobacterium longum NCC2705
Position: -45
Score: 4.99614
Sequence: AGTTGTGAACGTTAACATGG
Locus tag: BL1533
Name: null
Funciton: Biotin-protein ligase (EC 6.3.4.15)
BL1533 -45 5 AGTTGTGAACGTTAACATGG BL1533
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -107
Score: 4.91561
Sequence: AGTTGTGAACGTTAACACGG
Locus tag: Blon_2288
Name: null
Funciton: Biotin-protein ligase (EC 6.3.4.15)
Blon_2288 -107 4.9 AGTTGTGAACGTTAACACGG Blon_2288