Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Blon_2290 gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium breve DSM 20213
Position: -213
Score: 5.22251
Sequence: CGGTGTGAACGCTCACACGT
Locus tag: BIFBRE_00165
Name: null
Funciton: hypothetical protein
Locus tag: BIFBRE_00164
Name: null
Funciton: Regulator of polyketide synthase expression
BIFBRE_00165-BIFBRE_00164 -213 5.2 CGGTGTGAACGCTCACACGT BIFBRE_00165
Bifidobacterium longum NCC2705
Position: -123
Score: 4.99614
Sequence: CCATGTTAACGTTCACAACT
Locus tag: BL1532
Name: null
Funciton: hypothetical protein
Locus tag: BL1531
Name: null
Funciton: Regulator of polyketide synthase expression
BL1532-BL1531 -123 5 CCATGTTAACGTTCACAACT BL1532
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -144
Score: 4.91561
Sequence: CCGTGTTAACGTTCACAACT
Locus tag: Blon_2289
Name: null
Funciton: hypothetical protein
Locus tag: Blon_2290
Name: null
Funciton: Regulator of polyketide synthase expression
Blon_2289-Blon_2290 -144 4.9 CCGTGTTAACGTTCACAACT Blon_2289