Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing malE gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium breve DSM 20213
Position: -229
Score: 4.92302
Sequence: GCATGTTAGCGCTCTCATTG
Locus tag: BIFBRE_00012
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malE -229 4.9 GCATGTTAGCGCTCTCATTG BIFBRE_00012
Bifidobacterium longum NCC2705
Position: -246
Score: 5.36728
Sequence: ATATGTTAGCGCTCTCATAA
Locus tag: BL0141
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malE -246 5.4 ATATGTTAGCGCTCTCATAA BL0141
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -227
Score: 5.1073
Sequence: ATATGTTAGCGCTCTCATGA
Locus tag: Blon_2444
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malE -227 5.1 ATATGTTAGCGCTCTCATGA Blon_2444