Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Blon_1763 gene

Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium breve DSM 20213
Position: -108
Score: 5.42046
Locus tag: BIFBRE_01039
Name: glgB
Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC
Locus tag: BIFBRE_01038
Name: null
Funciton: response regulator of two-component system
Locus tag: BIFBRE_01037
Name: null
Funciton: histidine kinase sensor of two-component system
Bifidobacterium longum NCC2705
Position: -147
Score: 5.3485
Locus tag: BL0999
Name: glgB
Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC
Locus tag: BL1000
Name: null
Funciton: response regulator of two-component system
Locus tag: BL1001
Name: null
Funciton: histidine kinase sensor of two-component system
glgB-BL1000-BL1001 -147 5.3 CTATGAGAGCGCTCACAACC BL0999
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -108
Score: 5.3485
Locus tag: Blon_1761
Name: glgB
Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC
Locus tag: Blon_1762
Name: null
Funciton: response regulator of two-component system
Locus tag: Blon_1763
Name: null
Funciton: histidine kinase sensor of two-component system
glgB-Blon_1762-Blon_1763 -108 5.3 CTATGAGAGCGCTCACAACC Blon_1761