Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing galM gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -57
Score: 4.96306
Sequence: CATCGTGAGCGGTAACATAG
Locus tag: BAD_1082
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM -57 5 CATCGTGAGCGGTAACATAG BAD_1082
Bifidobacterium angulatum DSM 20098
Position: -51
Score: 5.06915
Sequence: ATGTGTTAGCGGTAACAACC
Locus tag: BIFANG_01641
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM -51 5.1 ATGTGTTAGCGGTAACAACC BIFANG_01641
Bifidobacterium bifidum NCIMB 41171
Position: -44
Score: 4.46802
Sequence: GATAGCGAGCGGTAACAATA
Locus tag: BbifN4_010100002474
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM -44 4.5 GATAGCGAGCGGTAACAATA BbifN4_010100002474
Bifidobacterium dentium Bd1
Position: -56
Score: 4.77792
Sequence: GACCGTTAGCGGTAACAACC
Locus tag: BDP_1518
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM -56 4.8 GACCGTTAGCGGTAACAACC BDP_1518
Bifidobacterium longum NCC2705
Position: -43
Score: 5.44467
Sequence: GATTGTGAGCGATAACAATT
Locus tag: BL1359
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM -43 5.4 GATTGTGAGCGATAACAATT BL1359
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -43
Score: 5.3759
Sequence: GATTGTGAGCGGTAACAATC
Locus tag: Blon_0896
Name: galM
Funciton: Aldose 1-epimerase (EC 5.1.3.3)
galM -43 5.4 GATTGTGAGCGGTAACAATC Blon_0896