Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tal gene

Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -156
Score: 6.05322
Locus tag: BAD_0829
Name: tkt
Funciton: Transketolase (EC
Locus tag: BAD_0830
Name: tal
Funciton: Transaldolase (EC
tkt-tal -156 6.1 AATTGTGAGCGCTAACAGCA BAD_0829
Bifidobacterium bifidum NCIMB 41171
Position: -159
Score: 5.8219
Locus tag: BbifN4_010100004774
Name: tkt
Funciton: Transketolase (EC
Locus tag: BbifN4_010100004779
Name: tal
Funciton: Transaldolase (EC
tkt-tal -159 5.8 ACTTGTGAGCGCTAACATAA BbifN4_010100004774
Bifidobacterium breve DSM 20213
Position: -156
Score: 5.76995
Locus tag: BIFBRE_01332
Name: tkt
Funciton: Transketolase (EC
Locus tag: BIFBRE_01331
Name: tal
Funciton: Transaldolase (EC
Bifidobacterium dentium Bd1
Position: -157
Score: 5.70118
Locus tag: BDP_1145
Name: tkt
Funciton: Transketolase (EC
Locus tag: BDP_1144
Name: tal
Funciton: Transaldolase (EC
tkt-tal -157 5.7 CATTGTGAACGCTAACAGAA BDP_1145
Bifidobacterium longum NCC2705
Position: -156
Score: 5.6202
Locus tag: BL0716
Name: tkt
Funciton: Transketolase (EC
Locus tag: BL0715
Name: tal
Funciton: Transaldolase (EC
tkt-tal -156 5.6 CACTGTGAACGCTAACAGAA BL0716
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -156
Score: 5.29383
Locus tag: Blon_1096
Name: tkt
Funciton: Transketolase (EC
Locus tag: Blon_1095
Name: tal
Funciton: Transaldolase (EC
tkt-tal -156 5.3 CACTGTGAACGTTAACAGAA Blon_1096