Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ldh gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -23
Score: 6.15515
Sequence: GTATGTGAGCGCTCACAAAA
Locus tag: BAD_1117
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh -23 6.2 GTATGTGAGCGCTCACAAAA BAD_1117
Bifidobacterium angulatum DSM 20098
Position: -102
Score: 4.7004
Sequence: CGATGTGAGCGCTGCCAGTG
Locus tag: BIFANG_00987
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh -102 4.7 CGATGTGAGCGCTGCCAGTG BIFANG_00987
Bifidobacterium bifidum NCIMB 41171
Position: -163
Score: 5.7857
Sequence: GTCTGTGAGCGTTCACAACA
Locus tag: BbifN4_010100002254
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh -163 5.8 GTCTGTGAGCGTTCACAACA BbifN4_010100002254
Bifidobacterium breve DSM 20213
Position: -160
Score: 5.86575
Sequence: GGCTGTGAGCGCTAACAACT
Locus tag: BIFBRE_01807
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh -160 5.9 GGCTGTGAGCGCTAACAACT BIFBRE_01807
Bifidobacterium dentium Bd1
Position: -162
Score: 6.11206
Sequence: GTTTGTGAGCGCTCACATCA
Locus tag: BDP_1558
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh -162 6.1 GTTTGTGAGCGCTCACATCA BDP_1558
Bifidobacterium longum NCC2705
Position: -160
Score: 5.6724
Sequence: ATTCGTGAGCGCTAACAACC
Locus tag: BL1308
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh -160 5.7 ATTCGTGAGCGCTAACAACC BL1308
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -160
Score: 5.28743
Sequence: GTTTGGGAGCGCTAACAACC
Locus tag: Blon_0840
Name: ldh
Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
ldh -160 5.3 GTTTGGGAGCGCTAACAACC Blon_0840