Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing gap gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -156
Score: 5.08363
Sequence: GCATGTGAGCGTTCACTGAA
Locus tag: BAD_1079
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap -156 5.1 GCATGTGAGCGTTCACTGAA BAD_1079
Bifidobacterium bifidum NCIMB 41171
Position: -155
Score: 5.29604
Sequence: ATTTGTTAGCGTTAACGGAA
Locus tag: BbifN4_010100002494
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap -155 5.3 ATTTGTTAGCGTTAACGGAA BbifN4_010100002494
Bifidobacterium breve DSM 20213
Position: -155
Score: 6.16959
Sequence: CAATGTGAGCGCTCACAAAA
Locus tag: BIFBRE_01690
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap -155 6.2 CAATGTGAGCGCTCACAAAA BIFBRE_01690
Bifidobacterium dentium Bd1
Position: -156
Score: 5.5258
Sequence: CATTGTGAGCGTTCACGGAA
Locus tag: BDP_1514
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap -156 5.5 CATTGTGAGCGTTCACGGAA BDP_1514
Bifidobacterium longum NCC2705
Position: -155
Score: 6.23836
Sequence: AATTGTGAGCGCTCACAGAA
Locus tag: BL1363
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap -155 6.2 AATTGTGAGCGCTCACAGAA BL1363
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -155
Score: 6.31934
Sequence: AATTGTGAGCGCTCACAAAA
Locus tag: Blon_0900
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap -155 6.3 AATTGTGAGCGCTCACAAAA Blon_0900
Gardnerella vaginalis 409-05
Position: -161
Score: 4.89485
Sequence: GCATGTTAACGCTCACTGTT
Locus tag: HMPREF0424_0471
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
gap -161 4.9 GCATGTTAACGCTCACTGTT HMPREF0424_0471