Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing eno gene

Properties
Regulog: AraQ - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -106
Score: 5.2918
Sequence: GAGTGTGAGCGTTCACATGG
Locus tag: BAD_0645
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -106 5.3 GAGTGTGAGCGTTCACATGG BAD_0645
Bifidobacterium animalis subsp. lactis AD011
Position: -104
Score: 5.18325
Sequence: TCGTGGGAGCGCTCACATTT
Locus tag: BLA_1030
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -104 5.2 TCGTGGGAGCGCTCACATTT BLA_1030
Bifidobacterium bifidum NCIMB 41171
Position: -105
Score: 5.32738
Sequence: GAATGTTAGCGCTCATATTA
Locus tag: BbifN4_010100003174
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -105 5.3 GAATGTTAGCGCTCATATTA BbifN4_010100003174
Bifidobacterium breve DSM 20213
Position: -108
Score: 6.1265
Sequence: CATTGTGAGCGCTCACATCA
Locus tag: BIFBRE_01016
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -108 6.1 CATTGTGAGCGCTCACATCA BIFBRE_01016
Bifidobacterium dentium Bd1
Position: -106
Score: 5.48783
Sequence: GTATGTGAGCGTTCACATGA
Locus tag: BDP_0870
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -106 5.5 GTATGTGAGCGTTCACATGA BDP_0870
Bifidobacterium gallicum DSM 20093
Position: -104
Score: 4.47569
Sequence: ACATGTGAACACTCACTGCA
Locus tag: BIFGAL_01223
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -104 4.5 ACATGTGAACACTCACTGCA BIFGAL_01223
Bifidobacterium longum NCC2705
Position: -108
Score: 5.64402
Sequence: CATTGTGAGCGCTAACGCTA
Locus tag: BL1022
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -108 5.6 CATTGTGAGCGCTAACGCTA BL1022
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -108
Score: 5.96145
Sequence: CATTGTGAGCGCTAACACTA
Locus tag: Blon_1836
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -108 6 CATTGTGAGCGCTAACACTA Blon_1836
Gardnerella vaginalis 409-05
Position: -106
Score: 5.28629
Sequence: TATTGTGAACGTTCACGGCA
Locus tag: HMPREF0424_0662
Name: eno
Funciton: Enolase (EC 4.2.1.11)
eno -106 5.3 TATTGTGAACGTTCACGGCA HMPREF0424_0662