Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rbsR1 gene

Properties
Regulog: RbsR1 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Ribose utilization
Effector: Ribose
Phylum: Actinobacteria
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -232
Score: 6.61805
Sequence: TTGTGGTAACGTTACCGCAT
Position: -187
Score: 7.03896
Sequence: ATGAGGTAACGTTACCGCAT
Locus tag: BDP_0171
Name: rbsR1
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsR1 -232 6.6 TTGTGGTAACGTTACCGCAT BDP_0171
-187 7 ATGAGGTAACGTTACCGCAT
Gardnerella vaginalis 409-05
Position: -281
Score: 7.12754
Sequence: TTGCGGTAACGTTACCGCAT
Position: -237
Score: 5.13559
Sequence: TTGTGGGAACGTTATCTCAA
Locus tag: HMPREF0424_1339
Name: rbsR1
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: HMPREF0424_1338
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: HMPREF0424_1337
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: HMPREF0424_1336
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: HMPREF0424_1335
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: HMPREF0424_1334
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsR1-rbsA-rbsC-rbsB-rbsD-rbsK -281 7.1 TTGCGGTAACGTTACCGCAT HMPREF0424_1339
-237 5.1 TTGTGGGAACGTTATCTCAA