Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hxlP gene

Regulog: HxlR - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Hexulose metabolism
Phylum: Actinobacteria
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium angulatum DSM 20098
Position: -131
Score: 5.48331
Position: -96
Score: 5.60836
Position: -83
Score: 5.46115
Locus tag: BIFANG_01235
Name: hxlP
Funciton: Predicted hexulose permease
Locus tag: BIFANG_01234
Name: usp
Funciton: Predicted sugar phosphate isomerase/epimerase
Locus tag: BIFANG_01233
Name: hxlK
Funciton: Predicted hexulose kinase
Locus tag: BIFANG_01232
Name: hxlA
Funciton: 3-hexulose 6-phosphate formaldehyde-lyase
Locus tag: BIFANG_01231
Name: hxlB
Funciton: Predicted 6-phospho-3-hexuloisomerase
hxlP-usp-hxlK-hxlA-hxlB -131 5.5 GTAGTTAACCGGTACACATG BIFANG_01235
Bifidobacterium dentium Bd1
Position: -132
Score: 6.2838
Position: -97
Score: 6.2838
Locus tag: BDP_0010
Name: hxlP
Funciton: Predicted hexulose permease
Locus tag: BDP_0011
Name: usp
Funciton: Predicted sugar phosphate isomerase/epimerase
Locus tag: BDP_0012
Name: hxlK
Funciton: Predicted hexulose kinase
Locus tag: BDP_0013
Name: hxlA
Funciton: 3-hexulose 6-phosphate formaldehyde-lyase
Locus tag: BDP_0014
Name: hxlB
Funciton: Predicted 6-phospho-3-hexuloisomerase
hxlP-usp-hxlK-hxlA-hxlB -132 6.3 GTAGTTAACCGGTAAACAAA BDP_0010