Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing BDP_0126 gene

Properties
Regulog: BLA_0143 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -162
Score: 5.38385
Sequence: CAACTTAAGCGCTTGACAAA
Locus tag: BDP_0125
Name: null
Funciton: ABC transport system, sugar-binding component
Locus tag: BDP_0126
Name: null
Funciton: ABC-type sugar transport system, permease component
Locus tag: BDP_0127
Name: null
Funciton: ABC-type sugar transport system, permease component
Locus tag: BDP_0128
Name: bmnA
Funciton: Beta-mannosidase (EC 3.2.1.25)
BDP_0125-BDP_0126-BDP_0127-bmnA -162 5.4 CAACTTAAGCGCTTGACAAA BDP_0125