Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing nanE-II gene

Properties
Regulog: BLA_0143 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium animalis subsp. lactis AD011
Position: -199
Score: 5.66026
Sequence: CGACTTAAGCGCTTCAGTGA
Locus tag: BLA_0147
Name: null
Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
BLA_0147 -199 5.7 CGACTTAAGCGCTTCAGTGA BLA_0147
Bifidobacterium dentium Bd1
Position: -88
Score: 5.69602
Sequence: TGCATTAACCGCTTAAGTGA
Locus tag: BDP_1538
Name: null
Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
BDP_1538 -88 5.7 TGCATTAACCGCTTAAGTGA BDP_1538