Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bglA gene

Properties
Regulog: BLA_0143 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -30
Score: 5.69809
Sequence: TATCTTAACCGCTTCAGGAA
Locus tag: BDP_0124
Name: null
Funciton: Beta-glucosidase (EC 3.2.1.21)
BDP_0124 -30 5.7 TATCTTAACCGCTTCAGGAA BDP_0124
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -161
Score: 4.97743
Sequence: CGACTTAACCGCTTCAGATT
Locus tag: Blon_1905
Name: null
Funciton: Beta-glucosidase (EC 3.2.1.21)
Blon_1905 -161 5 CGACTTAACCGCTTCAGATT Blon_1905