Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing BLA_0143 gene

Properties
Regulog: BLA_0143 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium angulatum DSM 20098
Position: -41
Score: 4.25052
Sequence: TGGCTGAAGCGCTTCTTGCA
Locus tag: BIFANG_00310
Name: BLA_0143
Funciton: Transcriptional regulator, LacI family
BLA_0143 -41 4.3 TGGCTGAAGCGCTTCTTGCA BIFANG_00310
Bifidobacterium dentium Bd1
Position: -44
Score: 5.10123
Sequence: TTAAGTAATCGCTTAAGTTC
Locus tag: BDP_0129
Name: BLA_0143
Funciton: Transcriptional regulator, LacI family
BLA_0143 -44 5.1 TTAAGTAATCGCTTAAGTTC BDP_0129