Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SSF53850 gene

Properties
Regulog: BLA_0143 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium animalis subsp. lactis AD011
Position: -224
Score: 5.93786
Sequence: TATATTAAGCGGTTAAGTCA
Locus tag: BLA_0145
Name: SSF53850
Funciton: Periplasmic binding protein-like II superfamily
Locus tag: BLA_0144
Name: PF04854
Funciton: Protein of unknown function, DUF624
SSF53850-PF04854 -224 5.9 TATATTAAGCGGTTAAGTCA BLA_0145
Bifidobacterium dentium Bd1
Position: -98
Score: 5.99179
Sequence: TATATTAAGCGCTTAAGTAG
Locus tag: BDP_0133
Name: SSF53850
Funciton: Periplasmic binding protein-like II superfamily
Locus tag: BDP_0132
Name: PF04854
Funciton: Protein of unknown function, DUF624
SSF53850-PF04854 -98 6 TATATTAAGCGCTTAAGTAG BDP_0133