Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing BDP_0134 gene

Properties
Regulog: BLA_0143 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Actinobacteria
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -110
Score: 5.99179
Sequence: CTACTTAAGCGCTTAATATA
Locus tag: BDP_0134
Name: null
Funciton: alpha-galactosidase
BDP_0134 -110 6 CTACTTAAGCGCTTAATATA BDP_0134