Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tcyP gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: 32
Score: 5.53366
Sequence: TAATTCTTAgTAtTcTtATAGGAtTac
Locus tag: MCCL_0267
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP 32 5.5 TAATTCTTAgTAtTcTtATAGGAtTac MCCL_0267
Staphylococcus aureus subsp. aureus N315
Position: -54
Score: 5.7921
Sequence: TTATTCTTAGCATACTAGTCGGAATTA
Locus tag: SA0368
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP -54 5.8 TTATTCTTAGCATACTAGTCGGAATTA SA0368
Staphylococcus capitis SK14
Position: -57
Score: 5.09002
Sequence: ATATCCTTATTATATATGTCGGAATAC
Locus tag: STACA0001_1450
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP -57 5.1 ATATCCTTATTATATATGTCGGAATAC STACA0001_1450
Staphylococcus carnosus subsp. carnosus TM300
Position: -269
Score: 5.03927
Sequence: TAAATACGATATATTTACTAAGGATTT
Position: -151
Score: 4.29571
Sequence: TTTTACCTACATAACTACTATTTAAAA
Locus tag: Sca_0042
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP -269 5 TAAATACGATATATTTACTAAGGATTT Sca_0042
-151 4.3 TTTTACCTACATAACTACTATTTAAAA
Staphylococcus epidermidis ATCC 12228
Position: -56
Score: 5.29314
Sequence: TTATTCTTATTACATATGTCGGAATAC
Locus tag: SE2354
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP -56 5.3 TTATTCTTATTACATATGTCGGAATAC SE2354
Staphylococcus haemolyticus JCSC1435
Position: -49
Score: 5.41275
Sequence: TTATCCTTATTAAGTATGTCGGAATTA
Locus tag: SH2589
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP -49 5.4 TTATCCTTATTAAGTATGTCGGAATTA SH2589
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -63
Score: 4.61715
Sequence: ATATCCTTAGTATACGTATCGGATTTC
Locus tag: SSP2329
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP -63 4.6 ATATCCTTAGTATACGTATCGGATTTC SSP2329