Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tcyC gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -38
Score: 5.25548
Sequence: CTATTCCGAGTAAATTGATATGAATAG
Locus tag: MCCL_1425
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: MCCL_1424
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: MCCL_1423
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA-tcyB-tcyC -38 5.3 CTATTCCGAGTAAATTGATATGAATAG MCCL_1425
Staphylococcus aureus subsp. aureus N315
Position: -40
Score: 6.18547
Sequence: TTATTCCGATTAGAATAATAAGAATAA
Locus tag: SA2202
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: SA2201
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: SA2200
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA-tcyB-tcyC -40 6.2 TTATTCCGATTAGAATAATAAGAATAA SA2202
Staphylococcus capitis SK14
Position: -40
Score: 6.04113
Sequence: TTATTCCGATTAGAATAATAAGATTAA
Locus tag: STACA0001_1063
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: STACA0001_1064
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: STACA0001_1065
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA-tcyB-tcyC -40 6 TTATTCCGATTAGAATAATAAGATTAA STACA0001_1063
Staphylococcus carnosus subsp. carnosus TM300
Position: -40
Score: 5.35489
Sequence: TTATTCCGATGAGAATGATAAGGATAA
Locus tag: Sca_1910
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: Sca_1909
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: Sca_1908
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA-tcyB-tcyC -40 5.4 TTATTCCGATGAGAATGATAAGGATAA Sca_1910
Staphylococcus epidermidis ATCC 12228
Position: -40
Score: 6.18547
Sequence: TTATTCCGATTAGAATAATAAGAATAA
Locus tag: SE1993
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: SE1992
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: SE1991
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA-tcyB-tcyC -40 6.2 TTATTCCGATTAGAATAATAAGAATAA SE1993
Staphylococcus haemolyticus JCSC1435
Position: -41
Score: 5.90865
Sequence: TTATTCTGACTAATCTAATAGGAATAT
Locus tag: SH0639
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: SH0640
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: SH0641
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA-tcyB-tcyC -41 5.9 TTATTCTGACTAATCTAATAGGAATAT SH0639
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -37
Score: 5.81712
Sequence: TTATTCCGATAAGAATAATAAGAATAG
Locus tag: SSP0242
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: SSP0243
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: SSP0244
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA-tcyB-tcyC -37 5.8 TTATTCCGATAAGAATAATAAGAATAG SSP0242