Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ssuA gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -41
Score: 6.02987
Sequence: TAATTCCTATTAAAATAGTAGGGATTA
Locus tag: SA0166
Name: ssuB
Funciton: sulfonate ABC transporter, ATPase component
Locus tag: SA0167
Name: ssuA
Funciton: sulfonate ABC transporter, substrate-binding component
Locus tag: SA0168
Name: ssuC
Funciton: sulfonate ABC transporter, permease component
Locus tag: SA0169
Name: SA0169
Funciton: putative acyl-CoA dehydrogenase
ssuB-ssuA-ssuC-SA0169 -41 6 TAATTCCTATTAAAATAGTAGGGATTA SA0166
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -41
Score: 5.71783
Sequence: CAATTCTTATTAAAACGATAAGAATAA
Locus tag: SSP0459
Name: ssuB
Funciton: sulfonate ABC transporter, ATPase component
Locus tag: SSP0458
Name: ssuA
Funciton: sulfonate ABC transporter, substrate-binding component
Locus tag: SSP0457
Name: ssuC
Funciton: sulfonate ABC transporter, permease component
Locus tag: SSP0456
Name: SA0169
Funciton: putative acyl-CoA dehydrogenase
ssuB-ssuA-ssuC-SA0169 -41 5.7 CAATTCTTATTAAAACGATAAGAATAA SSP0459