Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SA2080 gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -256
Score: 4.54588
Sequence: TATTTCCTAGATAATAAATAATGTATT
Locus tag: MCCL_0131
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080 -256 4.5 TATTTCCTAGATAATAAATAATGTATT MCCL_0131
Staphylococcus aureus subsp. aureus N315
Position: -62
Score: 4.58556
Sequence: TAAAGTCGAGTGTTAAACTAGGAATAA
Locus tag: SA2080
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080 -62 4.6 TAAAGTCGAGTGTTAAACTAGGAATAA SA2080
Staphylococcus capitis SK14
Position: -57
Score: 4.21229
Sequence: AAAAGTCGAGTGTTAAACTAGGATTAA
Locus tag: STACA0001_1208
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080 -57 4.2 AAAAGTCGAGTGTTAAACTAGGATTAA STACA0001_1208
Staphylococcus carnosus subsp. carnosus TM300
Position: -56
Score: 4.38511
Sequence: TTAATCCGAGTGATACACTAAACTTAA
Locus tag: Sca_1777
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080 -56 4.4 TTAATCCGAGTGATACACTAAACTTAA Sca_1777
Staphylococcus epidermidis ATCC 12228
Position: -65
Score: 4.41296
Sequence: TAAAGTCGAGTGTTAAACTATGAATAA
Locus tag: SE1858
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080 -65 4.4 TAAAGTCGAGTGTTAAACTATGAATAA SE1858
Staphylococcus haemolyticus JCSC1435
Position: -266
Score: 4.35193
Sequence: TAATGTCGAGTGATAAACTAGGTTTAA
Locus tag: SH0767
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080 -266 4.4 TAATGTCGAGTGATAAACTAGGTTTAA SH0767
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -110
Score: 5.12883
Sequence: TAAATCTTATCGGTAAAGTAAGGATTT
Locus tag: SSP0622
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080 -110 5.1 TAAATCTTATCGGTAAAGTAAGGATTT SSP0622