Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SA1850 gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -40
Score: 5.764
Sequence: TATTTCTTACTAAATCTATCGGAATTA
Locus tag: MCCL_0379
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850 -40 5.8 TATTTCTTACTAAATCTATCGGAATTA MCCL_0379
Staphylococcus aureus subsp. aureus N315
Position: -40
Score: 5.17471
Sequence: TAATACATACTAAACTTATCGGAAATG
Locus tag: SA1850
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850 -40 5.2 TAATACATACTAAACTTATCGGAAATG SA1850
Staphylococcus carnosus subsp. carnosus TM300
Position: -38
Score: 4.80801
Sequence: TAAAACTTACTAACATTATCGGAAAAG
Locus tag: Sca_1551
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850 -38 4.8 TAAAACTTACTAACATTATCGGAAAAG Sca_1551
Staphylococcus epidermidis ATCC 12228
Position: -35
Score: 4.56744
Sequence: AATACCTTAGTATTTATATCGGAAAAG
Locus tag: SE1646
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850 -35 4.6 AATACCTTAGTATTTATATCGGAAAAG SE1646
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -37
Score: 5.12404
Sequence: TTAATCTTATTGATTTTATCGGGAAAG
Locus tag: SSP0834
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850 -37 5.1 TTAATCTTATTGATTTTATCGGGAAAG SSP0834