Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SA0198 gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -77
Score: 4.77743
Sequence: TAATCTTGAGTAGATTACTATGATATA
Locus tag: SA0198
Name: SA0198
Funciton: oligopeptide transport ATP-binding protein
SA0198 -77 4.8 TAATCTTGAGTAGATTACTATGATATA SA0198