Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SA0165 gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -59
Score: 4.93951
Sequence: GTAATCCGATAAGAATTATAGTAATAT
Locus tag: SA0165
Name: SA0165
Funciton: hypothetical protein
SA0165 -59 4.9 GTAATCCGATAAGAATTATAGTAATAT SA0165
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -69
Score: 4.79243
Sequence: CATATCCTTGTAATCTGATAAGATTTA
Locus tag: SSP0460
Name: SA0165
Funciton: hypothetical protein
SA0165 -69 4.8 CATATCCTTGTAATCTGATAAGATTTA SSP0460