Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing metQ2 gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -42
Score: 5.75824
Sequence: TTATTCCTAGTGGATTAATAAGAATTT
Locus tag: SA0420
Name: metN2
Funciton: methionine ABC transporter paralog, ATP-binding protein MetN2
Locus tag: SA0421
Name: metP2
Funciton: methionine ABC transporter paralog, permease protein MetP2
Locus tag: SA0422
Name: metQ2
Funciton: methionine ABC transporter paralog, substrate-binding protein MetQ2
metN2-metP2-metQ2 -42 5.8 TTATTCCTAGTGGATTAATAAGAATTT SA0420
Staphylococcus capitis SK14
Position: -43
Score: 5.39689
Sequence: ATATTCAGATAAGTATAATCAGAATTG
Locus tag: STACA0001_1483
Name: metN2
Funciton: methionine ABC transporter paralog, ATP-binding protein MetN2
Locus tag: STACA0001_1484
Name: metP2
Funciton: methionine ABC transporter paralog, permease protein MetP2
Locus tag: STACA0001_1485
Name: metQ2
Funciton: methionine ABC transporter paralog, substrate-binding protein MetQ2
metN2-metP2-metQ2 -43 5.4 ATATTCAGATAAGTATAATCAGAATTG STACA0001_1483
Staphylococcus epidermidis ATCC 12228
Position: -42
Score: 5.26907
Sequence: ATATTCAGATAATTTTAATCGGAAATT
Locus tag: SE2322
Name: metN2
Funciton: methionine ABC transporter paralog, ATP-binding protein MetN2
Locus tag: SE2321
Name: metP2
Funciton: methionine ABC transporter paralog, permease protein MetP2
Locus tag: SE2320
Name: metQ2
Funciton: methionine ABC transporter paralog, substrate-binding protein MetQ2
metN2-metP2-metQ2 -42 5.3 ATATTCAGATAATTTTAATCGGAAATT SE2322