Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing luxS gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -46
Score: 5.58334
Sequence: TAATCCCGAGTTATCTGATAAGAATAA
Locus tag: MCCL_1789
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: MCCL_1790
Name: mccB
Funciton: cystathionine gamma-lyase
Locus tag: MCCL_1791
Name: luxS
Funciton: S-ribosylhomocysteinase
mccA-mccB-luxS -46 5.6 TAATCCCGAGTTATCTGATAAGAATAA MCCL_1789
Staphylococcus aureus subsp. aureus N315
Position: -244
Score: 4.75591
Sequence: GAATTATTACTTATTCTATCGGTTTTA
Locus tag: SA1936
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS -244 4.8 GAATTATTACTTATTCTATCGGTTTTA SA1936
Staphylococcus capitis SK14
Position: -193
Score: 5.49013
Sequence: TAATTATTACTTATTCTATCGGAATAA
Locus tag: STACA0001_0838
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS -193 5.5 TAATTATTACTTATTCTATCGGAATAA STACA0001_0838
Staphylococcus carnosus subsp. carnosus TM300
Position: -110
Score: 4.67294
Sequence: TTATCCCGAGTAAACTTATCAACTTAA
Locus tag: Sca_1637
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS -110 4.7 TTATCCCGAGTAAACTTATCAACTTAA Sca_1637
Staphylococcus epidermidis ATCC 12228
Position: -182
Score: 5.57936
Sequence: TAATTATTACTTATTTTATCGGATTTA
Locus tag: SE1732
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS -182 5.6 TAATTATTACTTATTTTATCGGATTTA SE1732
Staphylococcus haemolyticus JCSC1435
Position: -182
Score: 5.57936
Sequence: TAATTATTACTTATTTTATCGGATTTA
Locus tag: SH0901
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS -182 5.6 TAATTATTACTTATTTTATCGGATTTA SH0901
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -159
Score: 5.13983
Sequence: TAATTATTACTTATTCTATCGGGTTTA
Locus tag: SSP0751
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS -159 5.1 TAATTATTACTTATTCTATCGGGTTTA SSP0751