Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing mccA gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -46
Score: 5.58334
Sequence: TAATCCCGAGTTATCTGATAAGAATAA
Locus tag: MCCL_1789
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: MCCL_1790
Name: mccB
Funciton: cystathionine gamma-lyase
Locus tag: MCCL_1791
Name: luxS
Funciton: S-ribosylhomocysteinase
mccA-mccB-luxS -46 5.6 TAATCCCGAGTTATCTGATAAGAATAA MCCL_1789
Staphylococcus aureus subsp. aureus N315
Position: -88
Score: 5.82057
Sequence: TAATTCTTATCTGAAAAGTAAGAATTA
Locus tag: SA0418
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: SA0419
Name: mccB
Funciton: cystathionine gamma-lyase
mccA-mccB -88 5.8 TAATTCTTATCTGAAAAGTAAGAATTA SA0418
Staphylococcus capitis SK14
Position: -96
Score: 5.37115
Sequence: TAATTCATACCTGATAAGTAAGAATTT
Locus tag: STACA0001_1480
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: STACA0001_1481
Name: mccB
Funciton: cystathionine gamma-lyase
mccA-mccB -96 5.4 TAATTCATACCTGATAAGTAAGAATTT STACA0001_1480
Staphylococcus carnosus subsp. carnosus TM300
Position: -92
Score: 5.5993
Sequence: TAATCCATATCAGTATAGTAGGAATAA
Locus tag: Sca_0086
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: Sca_0087
Name: mccB
Funciton: cystathionine gamma-lyase
mccA-mccB -92 5.6 TAATCCATATCAGTATAGTAGGAATAA Sca_0086
Staphylococcus epidermidis ATCC 12228
Position: -96
Score: 5.70436
Sequence: TAATTCATATCTGATAAGTAAGAATTA
Locus tag: SE2324
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: SE2323
Name: mccB
Funciton: cystathionine gamma-lyase
mccA-mccB -96 5.7 TAATTCATATCTGATAAGTAAGAATTA SE2324
Staphylococcus haemolyticus JCSC1435
Position: -109
Score: 5.42572
Sequence: TAATTCATAGTGATTGAGTAAGAATTA
Locus tag: SH2549
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: SH2548
Name: mccB
Funciton: cystathionine gamma-lyase
mccA-mccB -109 5.4 TAATTCATAGTGATTGAGTAAGAATTA SH2549
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -144
Score: 5.06379
Sequence: GTATGCTTACTGAAAAAGTAGGAATTA
Position: -57
Score: 5.03317
Sequence: TAATTCTTATCGGTATAGTAAGGTATT
Locus tag: SSP0252
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: SSP0253
Name: mccB
Funciton: cystathionine gamma-lyase
mccA-mccB -144 5.1 GTATGCTTACTGAAAAAGTAGGAATTA SSP0252
-57 5 TAATTCTTATCGGTATAGTAAGGTATT