Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cysK gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -50
Score: 5.36043
Sequence: TAAATCCGATAAGCGTAATAAGAATAA
Locus tag: MCCL_1900
Name: cysK
Funciton: cysteine synthase
cysK -50 5.4 TAAATCCGATAAGCGTAATAAGAATAA MCCL_1900
Staphylococcus aureus subsp. aureus N315
Position: -55
Score: 5.08397
Sequence: TATATCCGATAAATAAACTAAGATTTC
Locus tag: SA0471
Name: cysK
Funciton: cysteine synthase
cysK -55 5.1 TATATCCGATAAATAAACTAAGATTTC SA0471
Staphylococcus capitis SK14
Position: -57
Score: 4.89394
Sequence: TATATCCGATAGGAAAACTAAGTTTTA
Locus tag: STACA0001_2088
Name: cysK
Funciton: cysteine synthase
cysK -57 4.9 TATATCCGATAGGAAAACTAAGTTTTA STACA0001_2088
Staphylococcus carnosus subsp. carnosus TM300
Position: -143
Score: 4.44308
Sequence: GATATCCGATGAAATAGCTAAGATATA
Locus tag: Sca_0164
Name: cysK
Funciton: cysteine synthase
cysK -143 4.4 GATATCCGATGAAATAGCTAAGATATA Sca_0164
Staphylococcus epidermidis ATCC 12228
Position: -58
Score: 4.8227
Sequence: TATATCCGATAGAAAAACTAAGTATTG
Locus tag: SE2270
Name: cysK
Funciton: cysteine synthase
cysK -58 4.8 TATATCCGATAGAAAAACTAAGTATTG SE2270
Staphylococcus haemolyticus JCSC1435
Position: -56
Score: 4.94506
Sequence: TATATCCGATAGAAAAACTAAGTTTTA
Locus tag: SH2497
Name: cysK
Funciton: cysteine synthase
cysK -56 4.9 TATATCCGATAGAAAAACTAAGTTTTA SH2497
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -55
Score: 5.1095
Sequence: TATATCCGATTGAAAAAGTAGGTTTTA
Locus tag: SSP2243
Name: cysK
Funciton: cysteine synthase
cysK -55 5.1 TATATCCGATTGAAAAAGTAGGTTTTA SSP2243