Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SSP2405 gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -152
Score: 4.52675
Sequence: AATAACCTAGTATTCGTATCGGAAATA
Position: -58
Score: 4.58672
Sequence: TTAAACCTATTTAGACAATAATTATAA
Locus tag: SSP2408
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: SSP2407
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: SSP2406
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
Locus tag: SSP2405
Name: SSP2405
Funciton: sirohydrochlorin ferrochelatase
Locus tag: SSP2404
Name: sirC
Funciton: Precorrin-2 dehydrogenase
Locus tag: SSP2403
Name: ytnM
Funciton: conserved membrane protein YtnM
Locus tag: SSP2402
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: SSP2401
Name: cysC
Funciton: adenylylsulfate kinase
cysJ-cysI-cysG-SSP2405-sirC-ytnM-cysD-cysC -152 4.5 AATAACCTAGTATTCGTATCGGAAATA SSP2408
-58 4.6 TTAAACCTATTTAGACAATAATTATAA