Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cysC gene

Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus capitis SK14
Position: -246
Score: 4.71748
Locus tag: STACA0001_1811
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: STACA0001_1810
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: STACA0001_1809
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
Locus tag: STACA0001_1808
Name: sirC
Funciton: Precorrin-2 dehydrogenase
Locus tag: STACA0001_1807
Name: ytnM
Funciton: conserved membrane protein YtnM
Locus tag: STACA0001_1806
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: STACA0001_1805
Name: cysC
Funciton: adenylylsulfate kinase
cysJ-cysI-cysG-sirC-ytnM-cysD-cysC -246 4.7 TAAAGCATAGTATTCCGATAAGATATA STACA0001_1811
Staphylococcus carnosus subsp. carnosus TM300
Position: -105
Score: 5.35107
Locus tag: Sca_0062
Name: ytnM
Funciton: conserved membrane protein YtnM
Locus tag: Sca_0063
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: Sca_0064
Name: cysC
Funciton: adenylylsulfate kinase
Staphylococcus epidermidis ATCC 12228
Position: -273
Score: 4.71837
Locus tag: SE2180
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: SE2179
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: SE2178
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
Locus tag: SE2177
Name: sirC
Funciton: Precorrin-2 dehydrogenase
Locus tag: SE2176
Name: ytnM
Funciton: conserved membrane protein YtnM
Locus tag: SE2175
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: SE2174
Name: cysC
Funciton: adenylylsulfate kinase
cysJ-cysI-cysG-sirC-ytnM-cysD-cysC -273 4.7 CAAAACATAGTATTCCGATAAGAAATA SE2180
Staphylococcus haemolyticus JCSC1435
Position: -48
Score: 4.87171
Locus tag: SH0419
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: SH0420
Name: cysC
Funciton: adenylylsulfate kinase
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -152
Score: 4.52675
Position: -58
Score: 4.58672
Locus tag: SSP2408
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: SSP2407
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: SSP2406
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
Locus tag: SSP2405
Name: SSP2405
Funciton: sirohydrochlorin ferrochelatase
Locus tag: SSP2404
Name: sirC
Funciton: Precorrin-2 dehydrogenase
Locus tag: SSP2403
Name: ytnM
Funciton: conserved membrane protein YtnM
Locus tag: SSP2402
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: SSP2401
Name: cysC
Funciton: adenylylsulfate kinase
cysJ-cysI-cysG-SSP2405-sirC-ytnM-cysD-cysC -152 4.5 AATAACCTAGTATTCGTATCGGAAATA SSP2408