Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cysH gene

Properties
Regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 69 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus capitis SK14
Position: -71
Score: 5.50752
Sequence: TTATTCTGACAATTCAGATAGGAATTT
Locus tag: STACA0001_1812
Name: cysH
Funciton: phosphoadenosine phosphosulfate reductase
cysH -71 5.5 TTATTCTGACAATTCAGATAGGAATTT STACA0001_1812
Staphylococcus epidermidis ATCC 12228
Position: -68
Score: 4.98385
Sequence: TTATTCTGACAATTCTGATATGTTTTG
Locus tag: SE2181
Name: cysH
Funciton: phosphoadenosine phosphosulfate reductase
cysH -68 5 TTATTCTGACAATTCTGATATGTTTTG SE2181
Staphylococcus haemolyticus JCSC1435
Position: -152
Score: 4.51928
Sequence: TAAAACATAGTATTCTGATATGTTTTG
Position: -68
Score: 5.56749
Sequence: TTATTCTGACAATTCTGATAGGTATTA
Locus tag: SH0413
Name: cysH
Funciton: phosphoadenosine phosphosulfate reductase
Locus tag: SH0414
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: SH0415
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: SH0416
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
Locus tag: SH0417
Name: sirC
Funciton: Precorrin-2 dehydrogenase
Locus tag: SH0418
Name: ytnM
Funciton: conserved membrane protein YtnM
cysH-cysJ-cysI-cysG-sirC-ytnM -152 4.5 TAAAACATAGTATTCTGATATGTTTTG SH0413
-68 5.6 TTATTCTGACAATTCTGATAGGTATTA