Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rspR gene

Regulog: RspR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Phylum: Proteobacteria/Gamma
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromohalobacter salexigens DSM 3043
Position: -46
Score: 6.20975
Locus tag: Csal_2973
Name: rspR
Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
Locus tag: Csal_2974
Name: rspA
Funciton: D-mannonate dehydratase (EC, COG4948 family
Locus tag: Csal_2975
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: Csal_2976
Name: rspP
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
Locus tag: Csal_2977
Name: rspQ
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
Locus tag: Csal_2978
Name: rspM
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
Locus tag: Csal_2979
Name: rspD
Funciton: D-mannonate oxidoreductase (EC
Locus tag: Csal_2980
Name: uxuA
Funciton: Mannonate dehydratase (EC
rspR-rspA-rspB-rspP-rspQ-rspM-rspD-uxuA -46 6.2 CCAACTACCATACTAGTCAG Csal_2973