Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing uxaC2 gene

Properties
Regulog: RspR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Phylum: Proteobacteria/Gamma
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -133
Score: 5.60565
Sequence: TACACTTGTATGGTAGTAGA
Locus tag: CKO_03735
Name: uxaC2
Funciton: Uronate isomerase (EC 5.3.1.12)
Locus tag: CKO_03734
Name: COG2211
Funciton: Oligogalacturonide transporter
Locus tag: CKO_03733
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
uxaC2-COG2211-rspD -133 5.6 TACACTTGTATGGTAGTAGA CKO_03735