Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rspD gene

Properties
Regulog: RspR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Phylum: Proteobacteria/Gamma
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -133
Score: 5.60565
Sequence: TACACTTGTATGGTAGTAGA
Locus tag: CKO_03735
Name: uxaC2
Funciton: Uronate isomerase (EC 5.3.1.12)
Locus tag: CKO_03734
Name: COG2211
Funciton: Oligogalacturonide transporter
Locus tag: CKO_03733
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
uxaC2-COG2211-rspD -133 5.6 TACACTTGTATGGTAGTAGA CKO_03735
Enterobacter sp. 638
Position: -70
Score: 5.59139
Sequence: AATACTTGTATGGTAGTAGC
Locus tag: Ent638_1932
Name: rspA
Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
Locus tag: Ent638_1933
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: Ent638_1934
Name: rspC
Funciton: Putative gulonate transporter, MFS superfamily, COG2271 family
Locus tag: Ent638_1935
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
rspA-rspB-rspC-rspD -70 5.6 AATACTTGTATGGTAGTAGC Ent638_1932
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -37
Score: 5.34206
Sequence: TATACTTGTATGGTAGTCAG
Locus tag: ECA0917
Name: rspA
Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
Locus tag: ECA0918
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: ECA0919
Name: rspC
Funciton: Putative gulonate transporter, MFS superfamily, COG2271 family
Locus tag: ECA0920
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: ECA0921
Name: rspR
Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
rspA-rspB-rspC-rspD-rspR -37 5.3 TATACTTGTATGGTAGTCAG ECA0917
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -132
Score: 5.24367
Sequence: TCTTCTTGTATGGTAGTTGA
Locus tag: KPN_01587
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
rspD -132 5.2 TCTTCTTGTATGGTAGTTGA KPN_01587
Serratia proteamaculans 568
Position: -74
Score: 5.2965
Sequence: CATACTTGTATGGTAGTTAG
Locus tag: Spro_3563
Name: rspA
Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
Locus tag: Spro_3564
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: Spro_3565
Name: rspC
Funciton: Putative gulonate transporter, MFS superfamily, COG2271 family
Locus tag: Spro_3566
Name: rspD
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: Spro_3567
Name: rspR
Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
rspA-rspB-rspC-rspD-rspR -74 5.3 CATACTTGTATGGTAGTTAG Spro_3563