Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SSPP117 gene

Properties
Regulog: ArsR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Phylum: Firmicutes
Built upon 26 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -65
Score: 5.79358
Sequence: TACATAGACACTAATCTATATA
Position: -49
Score: 6.12752
Sequence: TATATAGATGTTAATCTATGGT
Locus tag: SSPP119
Name: arsD
Funciton: arsenical resistance operon trans-acting ArsD
Locus tag: SSPP118
Name: arsA
Funciton: arsenite-transporting ATPase
Locus tag: SSPP117
Name: SSPP117
Funciton: putative dehydrogenase
Locus tag: SSPP116
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SSPP115
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SSPP114
Name: arsC
Funciton: arsenate reductase
arsD-arsA-SSPP117-arsR-arsB-arsC -65 5.8 TACATAGACACTAATCTATATA SSPP119
-49 6.1 TATATAGATGTTAATCTATGGT