Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing arsC gene

Properties
Regulog: ArsR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Phylum: Firmicutes
Built upon 26 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -62
Score: 5.61829
Sequence: TATATAGACACTTATCTATATA
Position: -46
Score: 6.80126
Sequence: TATATAGATGTTAATCTATGTA
Locus tag: MCCL_1484
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: MCCL_1485
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: MCCL_1486
Name: arsC
Funciton: arsenate reductase
arsR-arsB-arsC -62 5.6 TATATAGACACTTATCTATATA MCCL_1484
-46 6.8 TATATAGATGTTAATCTATGTA
Staphylococcus aureus subsp. aureus N315
Position: -57
Score: 6.07528
Sequence: AACATAGACAATAATCTATATA
Position: -41
Score: 6.7219
Sequence: TATATAGATGTTAATCTATTTA
Locus tag: SAP016
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SAP017
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SAP018
Name: arsC
Funciton: arsenate reductase
arsR-arsB-arsC -57 6.1 AACATAGACAATAATCTATATA SAP016
-41 6.7 TATATAGATGTTAATCTATTTA
Staphylococcus capitis SK14
Position: -58
Score: 5.95417
Sequence: TATATAGATATTTGTCTATATA
Position: -42
Score: 6.79992
Sequence: TATATAGATGATAATCTATAAT
Locus tag: STACA0001_1318
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: STACA0001_1319
Name: arsB
Funciton: arsenical pump membrane protein
Locus tag: STACA0001_1320
Name: arsC
Funciton: arsenate reductase
arsR-arsB-arsC -58 6 TATATAGATATTTGTCTATATA STACA0001_1318
-42 6.8 TATATAGATGATAATCTATAAT
Staphylococcus epidermidis ATCC 12228
Position: -65
Score: 5.94069
Sequence: AACATAGACATTAATCTATATA
Position: -49
Score: 6.41042
Sequence: TATATAGATGTTAGTCTATAAT
Locus tag: SE0138
Name: arsD
Funciton: arsenical resistance operon trans-acting ArsD
Locus tag: SE0137
Name: arsA
Funciton: arsenite-transporting ATPase
Locus tag: SE0136
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SE0135
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SE0134
Name: arsC
Funciton: arsenate reductase
arsD-arsA-arsR-arsB-arsC -65 5.9 AACATAGACATTAATCTATATA SE0138
-49 6.4 TATATAGATGTTAGTCTATAAT
Staphylococcus haemolyticus JCSC1435
Position: -213
Score: 5.30959
Sequence: AATATAAATCAATATCTATATT
Position: -65
Score: 5.13435
Sequence: AACATAGACACCAATCTATATA
Position: -49
Score: 6.66533
Sequence: TATATAGATGTTAATCTATAAT
Locus tag: SH0112
Name: arsD
Funciton: arsenical resistance operon trans-acting ArsD
Locus tag: SH0111
Name: arsA
Funciton: arsenite-transporting ATPase
Locus tag: SH0110
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SH0109
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SH0108
Name: arsC
Funciton: arsenate reductase
arsD-arsA-arsR-arsB-arsC -213 5.3 AATATAAATCAATATCTATATT SH0112
-65 5.1 AACATAGACACCAATCTATATA
-49 6.7 TATATAGATGTTAATCTATAAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -65
Score: 5.79358
Sequence: TACATAGACACTAATCTATATA
Position: -49
Score: 6.12752
Sequence: TATATAGATGTTAATCTATGGT
Locus tag: SSPP119
Name: arsD
Funciton: arsenical resistance operon trans-acting ArsD
Locus tag: SSPP118
Name: arsA
Funciton: arsenite-transporting ATPase
Locus tag: SSPP117
Name: SSPP117
Funciton: putative dehydrogenase
Locus tag: SSPP116
Name: arsR
Funciton: arsenical resistance operon repressor
Locus tag: SSPP115
Name: arsB
Funciton: arsenic efflux pump protein
Locus tag: SSPP114
Name: arsC
Funciton: arsenate reductase
arsD-arsA-SSPP117-arsR-arsB-arsC -65 5.8 TACATAGACACTAATCTATATA SSPP119
-49 6.1 TATATAGATGTTAATCTATGGT