Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SH0113 gene

Properties
Regulog: ArsR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Phylum: Firmicutes
Built upon 26 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus haemolyticus JCSC1435
Position: -254
Score: 6.66533
Sequence: ATTATAGATTAACATCTATATA
Position: -238
Score: 5.13435
Sequence: TATATAGATTGGTGTCTATGTT
Position: -90
Score: 5.30959
Sequence: AATATAGATATTGATTTATATT
Locus tag: SH0113
Name: SH0113
Funciton: hypothetical protein
Locus tag: SH0114
Name: arsR3
Funciton: hypothetical protein
Locus tag: SH0115
Name: SE0140
Funciton: putative permease
Locus tag: SH0116
Name: SE0141
Funciton: hypothetical protein
SH0113-arsR3-SE0140-SE0141 -254 6.7 ATTATAGATTAACATCTATATA SH0113
-238 5.1 TATATAGATTGGTGTCTATGTT
-90 5.3 AATATAGATATTGATTTATATT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -257
Score: 6.12752
Sequence: ACCATAGATTAACATCTATATA
Position: -241
Score: 5.79358
Sequence: TATATAGATTAGTGTCTATGTA
Locus tag: SSPP120
Name: SH0113
Funciton: hypothetical protein
Locus tag: SSPP121
Name: arsR3
Funciton: arsenical resistance operon repressor-like protein
Locus tag: SSPP122
Name: SE0140
Funciton: putative permease
SH0113-arsR3-SE0140 -257 6.1 ACCATAGATTAACATCTATATA SSPP120
-241 5.8 TATATAGATTAGTGTCTATGTA