Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SE0141 gene

Regulog: ArsR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Phylum: Firmicutes
Built upon 26 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus epidermidis ATCC 12228
Position: -493
Score: 6.41042
Position: -477
Score: 5.94069
Position: -332
Score: 4.78764
Locus tag: SE0139
Name: arsR3
Funciton: arsenical resistance operon repressor-like protein
Locus tag: SE0140
Name: SE0140
Funciton: putative permease
Locus tag: SE0141
Name: SE0141
Funciton: hypothetical protein
arsR3-SE0140-SE0141 -493 6.4 ATTATAGACTAACATCTATATA SE0139
Staphylococcus haemolyticus JCSC1435
Position: -254
Score: 6.66533
Position: -238
Score: 5.13435
Position: -90
Score: 5.30959
Locus tag: SH0113
Name: SH0113
Funciton: hypothetical protein
Locus tag: SH0114
Name: arsR3
Funciton: hypothetical protein
Locus tag: SH0115
Name: SE0140
Funciton: putative permease
Locus tag: SH0116
Name: SE0141
Funciton: hypothetical protein
SH0113-arsR3-SE0140-SE0141 -254 6.7 ATTATAGATTAACATCTATATA SH0113